主要内容

rebasecuts

R2026b

Find restriction enzymes that cut nucleotide sequence

Syntax

[Enzymes, Sites] = rebasecuts(SeqNT)
rebasecuts(SeqNT, Group)
rebasecuts(SeqNT, [Q, R])
rebasecuts(SeqNT, S)

Input Arguments

SeqNTNucleotide sequence.
GroupCell array of character vectors or string vector representing the names of valid restriction enzymes.
Q, RBase positions that limit the search to all sites between base Q and base R.
SBase position that limits the search to all sites after base S.

Output Arguments

EnzymesCell array of character vectors containing the names of restriction enzymes from REBASE®, the Restriction Enzyme Database.
SitesVector of cut sites identified with the base position number before every cut.

Description

[Enzymes, Sites] = rebasecuts(SeqNT) finds all the restriction enzymes that cut SeqNT, a nucleotide sequence.

rebasecuts(SeqNT, Group) limits the search to Group, a list of enzymes.

rebasecuts(SeqNT, [Q, R]) limits the search to those enzymes that cut after the base position specified by Q and before the base position specified by R.

rebasecuts(SeqNT, S) limits the search to those enzymes that cut just after the base position specified by S.

REBASE, the Restriction Enzyme Database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE, see:

Examples

  1. Create a nucleotide sequence.

    seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';
  2. Find all possible enzymes and cleavage sites in the sequence.

     [enzymes, sites] = rebasecuts(seq)
  3. Find where restriction enzymes CfoI and Tru9I cut the sequence.

    [enzymes, sites] = rebasecuts(seq, {'CfoI','Tru9I'})
    
    enzymes = 
    
        'CfoI'
        'CfoI'
        'Tru9I'
    
    sites =
    
        13
        39
        45
  4. Find all possible enzymes that cut after base 7.

    enzymes  = rebasecuts(seq, 7)
    
    enzymes = 
    
        'Csp6I'
        'CviQI'
        'RsaNI'
  5. Find all possible enzymes that cut between bases 11 and 37.

    enzymes  = rebasecuts(seq, [11 37])
    
    enzymes = 
    
        'AccII'
        'AspLEI'
        'BmiI'
        'Bsh1236I'
        'BspFNI'
        'BspLI'
        'BstFNI'
        'BstHHI'
        'BstUI'
        'CfoI'
        'FnuDII'
        'GlaI'
        'HhaI'
        'Hin6I'
        'HinP1I'
        'Hpy188I'
        'HspAI'
        'MvnI'
        'NlaIV'
        'PspN4I'
        'SetI'

References

[1] Roberts, R.J., Vincze, T., Posfai, J., and Macelis, D. (2007). REBASE—enzymes and genes for DNA restriction and modification. Nucl. Acids Res. 35, D269–D270.

[2] Official REBASE Web site: https://rebase.neb.com/rebase/rebase.html.

Version History

Introduced before R2006a