seqwordcount
R2026bCount number of occurrences of word in sequence
Syntax
seqwordcount(Seq, Word)
Arguments
Seq | Character vector or string containing a nucleotide or amino acid sequence. You can also
enter a structure with the field
|
Word | Enter a short sequence of characters. |
Description
seqwordcount( counts
the number of times that a word appears in a sequence, and then returns
the number of occurrences of that word.Seq, Word)
If Word contains nucleotide or amino
acid symbols that represent multiple possible symbols (ambiguous characters),
then seqwordcount counts all matches. For example,
the symbol R represents either G or A (purines).
For another example, if word equals 'ART',
then seqwordcount counts occurrences of both 'AAT' and 'AGT'.
Examples
seqwordcount does not count overlapping patterns
multiple times. In the following example, seqwordcount reports
three matches. TATATATA is counted as two distinct
matches, not three overlapping occurrences.
seqwordcount('GCTATAACGTATATATAT','TATA') ans = 3
The following example reports two matches ('TAGT' and 'TAAT'). B is
the ambiguous code for G, T,
or C, while R is an ambiguous
code for G and A.
seqwordcount('GCTAGTAACGTATATATAAT','BART') ans = 2
Version History
Introduced before R2006a