rna2dna

Convert RNA sequence to DNA sequence

Syntax

SeqDNA = rna2dna(SeqRNA)

SeqDNA = rna2dna(SeqRNA) converts an RNA sequence to a DNA sequence by replacing uracil (U) nucleotides with thymine (T) nucleotides.

Generate a random RNA sequence.

rna = randseq(100,Alphabet='rna')

rna = 
'UUAUGACGUUAUUCUACUUUGAUUGUGCGAGACAAUGCUACCUUACCGGUCGGAACUCGAUCGGUUGAACUCUAUCACGCCUGGUCUUCGAAGUUAGCAC'

Convert the RNA sequence to a DNA sequence.

dna = rna2dna(rna)

dna = 
'TTATGACGTTATTCTACTTTGATTGTGCGAGACAATGCTACCTTACCGGTCGGAACTCGATCGGTTGAACTCTATCACGCCTGGTCTTCGAAGTTAGCAC'

RNA sequence, specified as one of the following.

Character vector or string scalar consisting of the characters A, C, G, and U, and ambiguous characters R, Y, K, M, S, W, B, D, H, V, and N.
Row vector of integers specifying a nucleotide sequence. For information on valid integers, see Mapping Nucleotide Integers to Letter Codes.
Structure that contains an RNA sequence in the Sequence field. The fastaread, fastqread, emblread, getembl, genbankread, and getgenbank functions return structures with a Sequence field.

Example: SeqDNA = dna2rna("CGACUU") replaces the instances of U with T.

Data Types: double | char | string | struct

DNA sequence, returned as a character vector or a row vector of integers.

If SeqRNA is a character vector or string scalar, then the function returns a character vector.
If SeqRNA is a row vector of integers, then the function returns a row vector of integers.
If SeqRNA is a structure, then the function returns SeqDNA with the same data type as the Sequence field, either a character vector or a row vector of integers.