Problem 797. Genome Sequence 003R: Sequence DNA of random positioned and flipped segments

Created by Richard Zapor

Solve Later

{"parts":[{"partUri":"/matlab/document.xml","contentType":"application/vnd.mathworks.matlab.code.document+xml","content":"<?xml version=\"1.0\" encoding=\"UTF-8\"?><w:document xmlns:w=\"http://schemas.openxmlformats.org/wordprocessingml/2006/main\"><w:body><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>This is Challenge 003R in the series on Genome DNA Sequencing. Challenge 3R includes flipped segments.</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>DNA Sequencing</w:t></w:r></w:hyperlink><w:r><w:t> is naively simplified into Cody Challenges.</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>Genome sizes</w:t></w:r></w:hyperlink><w:r><w:t> is another interesting wiki page.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Example:</w:t></w:r><w:r><w:t> Genome = ACGTCGGCCATGGACATTACG</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Given three overlapping pieces, ACGTCGGCCA, GCCATGGACATC, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as being reversed with asymetric overlaps to its adjacent segments.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"code\"/></w:pPr><w:r><w:t><![CDATA[ACGTCGGCCATGGACATTACG\nACGTCGGCCAsssssssssss\nssssGCCATGGACATCsssss Middle Rev\nssssCTACAGGTACCGsssss Middle flipped\nssssssssssssGACATTACG]]></w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome_003R Challenge is to reconstruct a genome under near ideal error free segment creation conditions. Segments may be reversed. The segments start at random locations.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segments may be reversed (Change from 003)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segments start at random positions</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome length is unconstrained</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Length of each segment - 48</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>All segments may overlap by 16 to 47 characters</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>No errors in the segments</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome is random (No duplicate starts or ends for 16 symbols of segments)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segment order is scrambled</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Input:</w:t></w:r><w:r><w:t> segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Output:</w:t></w:r><w:r><w:t> Gout, Genome vector of values [0,1,2,3]</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Example:</w:t></w:r><w:r><w:t> [0 1 2 3 2;1 1 2 2 3 2 ; 2 2 1 1 2] creates [0 1 2 3 2 2 1 1 2] W=5, Overlap=varies, Reverses may occur</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Future:</w:t></w:r><w:r><w:t> Flipped segments(002), Random Position of Segment start locations(003),Random Segment Positions with Flips (003R), Parrot Sequence with Gen3 Long Segments, Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments</w:t></w:r></w:p></w:body></w:document>","relationship":null}],"relationships":[{"relationshipType":"http://schemas.mathworks.com/matlab/code/2013/relationships/document","target":"/matlab/document.xml","relationshipId":"rId1"}]}

<div style = "text-align: start; line-height: 20.4333px; min-height: 0px; white-space: normal; color: rgb(0, 0, 0); font-family: Menlo, Monaco, Consolas, monospace; font-style: normal; font-size: 14px; font-weight: 400; text-decoration: rgb(0, 0, 0); white-space: normal; "><div style="block-size: 726.633px; display: block; min-width: 0px; padding-block-start: 0px; padding-top: 0px; perspective-origin: 407px 363.317px; transform-origin: 407px 363.317px; vertical-align: baseline; "><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 341px 8px; transform-origin: 341px 8px; unicode-bidi: normal; "><span style="">This is Challenge 003R in the series on Genome DNA Sequencing. Challenge 3R includes flipped segments.</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">DNA Sequencing</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 133.5px 8px; transform-origin: 133.5px 8px; unicode-bidi: normal; "><span style=""> is naively simplified into Cody Challenges.</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">Genome sizes</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 101.5px 8px; transform-origin: 101.5px 8px; unicode-bidi: normal; "><span style=""> is another interesting wiki page.</span></span></div><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 369px 8px; transform-origin: 369px 8px; unicode-bidi: normal; "><span style="">DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments.</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 31.5px 8px; transform-origin: 31.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Example:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 139px 8px; transform-origin: 139px 8px; unicode-bidi: normal; "><span style=""> Genome = ACGTCGGCCATGGACATTACG</span></span></div><div style="block-size: 63px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 31.5px; text-align: left; transform-origin: 384px 31.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 368.5px 8px; transform-origin: 368.5px 8px; unicode-bidi: normal; "><span style="">Given three overlapping pieces, ACGTCGGCCA, GCCATGGACATC, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as being reversed with asymetric overlaps to its adjacent segments.</span></span></div><div style="background-color: rgb(247, 247, 247); block-size: 102.167px; border-bottom-left-radius: 4px; border-bottom-right-radius: 4px; border-end-end-radius: 4px; border-end-start-radius: 4px; border-start-end-radius: 4px; border-start-start-radius: 4px; border-top-left-radius: 4px; border-top-right-radius: 4px; margin-block-end: 10px; margin-block-start: 10px; margin-bottom: 10px; margin-inline-end: 3px; margin-inline-start: 3px; margin-left: 3px; margin-right: 3px; margin-top: 10px; perspective-origin: 404px 51.0833px; transform-origin: 404px 51.0833px; margin-left: 3px; margin-top: 10px; margin-bottom: 10px; margin-right: 3px; "><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ACGTCGGCCATGGACATTACG</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ACGTCGGCCAsssssssssss</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 128px 8.5px; transform-origin: 128px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; perspective-origin: 88px 8.5px; transform-origin: 88px 8.5px; ">ssssGCCATGGACATCsssss </span><span style="border-block-end-color: rgb(170, 4, 249); border-block-start-color: rgb(170, 4, 249); border-bottom-color: rgb(170, 4, 249); border-inline-end-color: rgb(170, 4, 249); border-inline-start-color: rgb(170, 4, 249); border-left-color: rgb(170, 4, 249); border-right-color: rgb(170, 4, 249); border-top-color: rgb(170, 4, 249); caret-color: rgb(170, 4, 249); color: rgb(170, 4, 249); column-rule-color: rgb(170, 4, 249); margin-inline-end: 0px; margin-right: 0px; outline-color: rgb(170, 4, 249); perspective-origin: 40px 8.5px; text-decoration: none; text-decoration-color: rgb(170, 4, 249); text-emphasis-color: rgb(170, 4, 249); transform-origin: 40px 8.5px; ">Middle Rev</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 144px 8.5px; transform-origin: 144px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; perspective-origin: 88px 8.5px; transform-origin: 88px 8.5px; ">ssssCTACAGGTACCGsssss </span><span style="border-block-end-color: rgb(170, 4, 249); border-block-start-color: rgb(170, 4, 249); border-bottom-color: rgb(170, 4, 249); border-inline-end-color: rgb(170, 4, 249); border-inline-start-color: rgb(170, 4, 249); border-left-color: rgb(170, 4, 249); border-right-color: rgb(170, 4, 249); border-top-color: rgb(170, 4, 249); caret-color: rgb(170, 4, 249); color: rgb(170, 4, 249); column-rule-color: rgb(170, 4, 249); margin-inline-end: 0px; margin-right: 0px; outline-color: rgb(170, 4, 249); perspective-origin: 56px 8.5px; text-decoration: none; text-decoration-color: rgb(170, 4, 249); text-emphasis-color: rgb(170, 4, 249); transform-origin: 56px 8.5px; ">Middle flipped</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ssssssssssssGACATTACG</span></span></div></div><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 10px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 10px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 10px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 382px 8px; transform-origin: 382px 8px; unicode-bidi: normal; "><span style="">Genome_003R Challenge is to reconstruct a genome under near ideal error free segment creation conditions. Segments may be reversed. The segments start at random locations.</span></span></div><ol style="block-size: 163.467px; counter-reset: list-item 0; font-family: Helvetica, Arial, sans-serif; list-style-type: decimal; margin-block-end: 20px; margin-block-start: 10px; margin-bottom: 20px; margin-top: 10px; perspective-origin: 391px 81.7333px; transform-origin: 391px 81.7333px; margin-top: 10px; margin-bottom: 20px; "><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 148.5px 8px; transform-origin: 148.5px 8px; unicode-bidi: normal; "><span style="">Segments may be reversed (Change from 003)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 111.5px 8px; transform-origin: 111.5px 8px; unicode-bidi: normal; "><span style="">Segments start at random positions</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 102.5px 8px; transform-origin: 102.5px 8px; unicode-bidi: normal; "><span style="">Genome length is unconstrained</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 91px 8px; transform-origin: 91px 8px; unicode-bidi: normal; "><span style="">Length of each segment - 48</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 153.5px 8px; transform-origin: 153.5px 8px; unicode-bidi: normal; "><span style="">All segments may overlap by 16 to 47 characters</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 81.5px 8px; transform-origin: 81.5px 8px; unicode-bidi: normal; "><span style="">No errors in the segments</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 240px 8px; transform-origin: 240px 8px; unicode-bidi: normal; "><span style="">Genome is random (No duplicate starts or ends for 16 symbols of segments)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 88.5px 8px; transform-origin: 88.5px 8px; unicode-bidi: normal; "><span style="">Segment order is scrambled</span></span></li></ol><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 20px 8px; transform-origin: 20px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Input:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 213px 8px; transform-origin: 213px 8px; unicode-bidi: normal; "><span style=""> segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 26px 8px; transform-origin: 26px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Output:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 128.5px 8px; transform-origin: 128.5px 8px; unicode-bidi: normal; "><span style=""> Gout, Genome vector of values [0,1,2,3]</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 31.5px 8px; transform-origin: 31.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Example:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 324.5px 8px; transform-origin: 324.5px 8px; unicode-bidi: normal; "><span style=""> [0 1 2 3 2;1 1 2 2 3 2 ; 2 2 1 1 2] creates [0 1 2 3 2 2 1 1 2] W=5, Overlap=varies, Reverses may occur</span></span></div><div style="block-size: 84px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 42px; text-align: left; transform-origin: 384px 42px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 25.5px 8px; transform-origin: 25.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Future:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 355.5px 8px; transform-origin: 355.5px 8px; unicode-bidi: normal; "><span style=""> Flipped segments(002), Random Position of Segment start locations(003),Random Segment Positions with Flips (003R), Parrot Sequence with Gen3 Long Segments, Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments</span></span></div></div></div>

This is Challenge 003R in the series on Genome DNA Sequencing. Challenge 3R includes flipped segments. DNA Sequencing is naively simplified into Cody Challenges. Genome sizes is another interesting wiki page.
DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments.
Example: Genome = ACGTCGGCCATGGACATTACG
Given three overlapping pieces, ACGTCGGCCA, GCCATGGACATC, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as being reversed with asymetric overlaps to its adjacent segments.
ACGTCGGCCATGGACATTACG
ACGTCGGCCAsssssssssss
ssssGCCATGGACATCsssss Middle Rev
ssssCTACAGGTACCGsssss Middle flipped
ssssssssssssGACATTACG
Genome_003R Challenge is to reconstruct a genome under near ideal error free segment creation conditions. Segments may be reversed. The segments start at random locations.
Segments may be reversed (Change from 003)
Segments start at random positions
Genome length is unconstrained
Length of each segment - 48
All segments may overlap by 16 to 47 characters
No errors in the segments
Genome is random (No duplicate starts or ends for 16 symbols of segments)
Segment order is scrambled
Input: segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].
Output: Gout, Genome vector of values [0,1,2,3]
Example: [0 1 2 3 2;1 1 2 2 3 2 ; 2 2 1 1 2] creates [0 1 2 3 2 2 1 1 2] W=5, Overlap=varies, Reverses may occur
Future: Flipped segments(002), Random Position of Segment start locations(003),Random Segment Positions with Flips (003R), Parrot Sequence with Gen3 Long Segments, Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments

Solve

Solution Stats

6 Solutions
2 Solvers

Last Solution submitted on Jul 19, 2021

Last 200 Solutions

Problem Comments

1 Comment

1 Comment

Are Mjaavatten on 19 Jul 2021

The previous three sequencing problems are all medium to hard. Once you have solved those, this one is easy.

Solution Comments

Show comments

Problem Recent Solvers2

Problem Tags

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Problem 797. Genome Sequence 003R: Sequence DNA of random positioned and flipped segments

Solution Stats

Last 200 Solutions

Problem Comments

Solution Comments

Problem Recent Solvers2

Suggested Problems

More from this Author293

Problem Tags

Community Treasure Hunt

Problem 797. Genome Sequence 003R: Sequence DNA of random positioned and flipped segments

Solution Stats

Last 200 Solutions

Problem Comments

Solution Comments

Problem Recent Solvers2

Suggested Problems

More from this Author293

Problem Tags

Community Treasure Hunt

Players

WeChat