basecount

Count nucleotides in sequence

Syntax

NTStruct = basecount(SeqNT) NTStruct = basecount(SeqNT, ...'Ambiguous', AmbiguousValue, ...) NTStruct = basecount(SeqNT, ...'Gaps', GapsValue, ...) NTStruct = basecount(SeqNT, ...'Chart', ChartValue, ...)

Input Arguments

`SeqNT`	One of the following: Character vector or string containing codes specifying a nucleotide sequence. For valid letter codes, see the table Mapping Nucleotide Letter Codes to Integers Row vector of integers specifying a nucleotide sequence. For valid integers, see the table Mapping Nucleotide Integers to Letter Codes MATLAB^® structure containing a `Sequence` field that contains a nucleotide sequence, such as returned by `fastaread`, `fastqread`, `emblread`, `getembl`, `genbankread`, or `getgenbank`.
`AmbiguousValue`	Character vector or string specifying how to treat ambiguous nucleotide characters (`R`, `Y`, `K`, `M`, `S`, `W`, `B`, `D`, `H`, `V`, or `N`). Choices are: `'ignore'` (default) — Skips ambiguous characters `'bundle'` — Counts ambiguous characters and reports the total count in the `Ambiguous` field. `'prorate'` — Counts ambiguous characters and distributes them proportionately in the appropriate fields. For example, the counts for the character `R` are distributed evenly between the `A` and `G` fields. `'individual'` — Counts ambiguous characters and reports them in individual fields. `'warn'` — Skips ambiguous characters and displays a warning.
`GapsValue`	Specifies whether gaps, indicated by a hyphen (`-`), are counted or ignored. Choices are `true` or `false` (default).
`ChartValue`	Character vector or string specifying a chart type. Choices are `'pie'` or `'bar'`.

Output Arguments

NTStruct 1-by-1 MATLAB structure containing the fields A, C, G, and T.

Description

NTStruct = basecount(SeqNT) counts the number of each type of base in SeqNT, a nucleotide sequence, and returns the counts in NTStruct, a 1-by-1 MATLAB structure containing the fields A, C, G, and T.

The character U is added to the T field.
Ambiguous nucleotide characters (R, Y, K, M, S, W, B, D, H, V, or N), and gaps, indicated by a hyphen (-), are ignored by default.
Unrecognized characters are ignored and cause the following warning message.
```
Warning: Unknown symbols appear in the sequence. These will be ignored.
```

NTStruct = basecount(SeqNT, ...'PropertyName', PropertyValue, ...) calls basecount with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:

NTStruct = basecount(SeqNT, ...'Ambiguous', AmbiguousValue, ...) specifies how to treat ambiguous nucleotide characters (R, Y, K, M, S, W, B, D, H, V, or N). Choices are:

'ignore' (default)
'bundle'
'prorate'
'individual'
'warn'

NTStruct = basecount(SeqNT, ...'Gaps', GapsValue, ...) specifies whether gaps, indicated by a hyphen (-), are counted or ignored. Choices are true or false (default).

NTStruct = basecount(SeqNT, ...'Chart', ChartValue, ...) creates a chart showing the relative proportions of the nucleotides. ChartValue can be 'pie' or 'bar'.

Examples

collapse all

Count nucleotides in a sequence

Open Live Script

Count the bases in a DNA sequence and return the results in a structure.

bases = basecount('TAGCTGGCCAAGCGAGCTTG')

bases = struct with fields:
    A: 4
    C: 5
    G: 7
    T: 4

Get the count for adenosine (A) bases.

bases.A

ans = 4

Count the bases in a DNA sequence containing ambiguous characters (R, Y, K, M, S, W, B, D, H, V, or N), listing each of them in a separate field.

basecount('ABCDGGCCAAGCGAGCTTG','Ambiguous','individual')

ans = struct with fields:
    A: 4
    C: 5
    G: 6
    T: 2
    R: 0
    Y: 0
    K: 0
    M: 0
    S: 0
    W: 0
    B: 1
    D: 1
    H: 0
    V: 0
    N: 0

Version History

Introduced before R2006a