getSubsequence

Store read data from a SAM-formatted file in a BioRead object.

br = BioRead('ex1.sam')

br = 
  BioRead with properties:

     Quality: [1501x1 File indexed property]
    Sequence: [1501x1 File indexed property]
      Header: [1501x1 File indexed property]
       NSeqs: 1501
        Name: ''

Retrieve the sequences (reads) from the object.

seqs = getSequence(br);

Retrieve the first, third, and fifth sequences from the object.

seqs2 = getSequence(br,[1 3 5])

seqs2 = 3x1 cell
    {'CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG'}
    {'AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC' }
    {'GCTCATTGTAAATGTGTGGTTTAACTCGTCCATGG' }

Retrieve the first five positions of those sequences.

seqs3 = getSubsequence(br,[1 3 5],[1:5])

seqs3 = 3x1 cell
    {'CACTA'}
    {'AGTGG'}
    {'GCTCA'}

You can use a header to get the corresponding sequences with that header. If multiple sequences have the same header, the function returns all of those sequences.

Get the first five positions of the sequences with the header B7_591:4:96:693:509.

seqs4 = getSubsequence(br,{'B7_591:4:96:693:509'},[1:5])

seqs4 = 1x1 cell array
    {'CACTA'}

Retrieve the first, fourth, and sixth positions of the first three sequences.

seq5 = getSubsequence(br,[1:3],[1 4 6])

seq5 = 3x1 cell
    {'CTG'}
    {'CGG'}
    {'AGC'}