主要内容

rnaplot

R2026b

Draw secondary structure of RNA sequence

    Description

    rnaplot(RNA2ndStruct) draws the RNA secondary structure specified by RNA2ndStruct, the secondary structure of an RNA sequence represented by a string scalar or character vector specifying bracket notation or a connectivity matrix.

    example

    ha = rnaplot(RNA2ndStruct) returns ha, a handle to the figure axis.

    example

    [ha,H] = rnaplot(RNA2ndStruct) also returns H, a structure of handles, which you can use to graph elements in a MATLAB® figure window.

    ___ = rnaplot(RNA2ndStruct,Name=Value) specifies options using one or more name-value arguments in addition to the input arguments in previous syntaxes. For example, to color by residue type, set ColorBy to "Residue".

    example

    Examples

    collapse all

    Determine the minimum free-energy secondary structure of an RNA sequence and plot it in circle format.

    seq = "GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG";
    RNA2ndStructure = rnafold(seq);
    rnaplot(RNA2ndStructure)

    Figure contains an axes object. The hidden axes object contains 38 objects of type line, text. One or more of the lines displays its values using only markers These objects represent Paired, Unpaired.

    Plot the RNA sequence secondary structure in graph format and color the plot by pair type.

    seq = "GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG";
    RNA2ndStructure = rnafold(seq);
    rnaplot(RNA2ndStructure,Sequence=seq,Format="Graph",ColorBy="Pair")

    Figure contains an axes object. The axes object with xlabel Sequence position, ylabel Relative distance between paired bases contains 25 objects of type line. One or more of the lines displays its values using only markers These objects represent AU/UA, GU/UG, GC/CG, Unpaired.

    Plot the RNA sequence secondary structure in mountain format and color the plot by residue type. Use the handle ha to add a title to the plot.

    seq = "GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG";
    RNA2ndStructure = rnafold(seq);
    ha = rnaplot(RNA2ndStructure,Sequence=seq,Format="Mountain",ColorBy="Residue");
    title(ha,"Bacillus halodurans, tRNA Arg")

    Figure contains an axes object. The axes object with title Bacillus halodurans, tRNA Arg, xlabel Sequence position, ylabel Number of enclosing base pairs contains 5 objects of type line. One or more of the lines displays its values using only markers These objects represent A, C, G, U.

    Mutate the first six positions in an RNA sequence and observe the effect the mutation has on the secondary structure by highlighting the first six residues.

    seq = "GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG";
    seqMut = replaceBetween(seq,1,6,"AAAAAA");
    RNA2ndStructure = rnafold(seq);
    RNA2ndStructureMut = rnafold(seqMut);
    rnaplot(RNA2ndStructure,Sequence=seq,Format="DotDiagram",Selection=1:6)

    Figure contains an axes object. The hidden axes object contains 101 objects of type line, text. One or more of the lines displays its values using only markers These objects represent Paired, Unpaired, Selected.

    rnaplot(RNA2ndStructureMut,Sequence=seqMut,Format="DotDiagram",Selection=1:6)

    Figure contains an axes object. The hidden axes object contains 98 objects of type line, text. One or more of the lines displays its values using only markers These objects represent Paired, Unpaired, Selected.

    Input Arguments

    collapse all

    Secondary structure of RNA sequence, specified as a string scalar, character vector, or binary matrix. Use bracket notation to specify RNA2ndStruct as a string scalar or character vector, and use a binary matrix to specify RNA2ndStruct as a connectivity matrix.

    Tip

    You can use the rnafold function to create RNA2ndStruct.

    Data Types: string | char | logical | double | single | int8 | int16 | int32 | int64 | uint8 | uint16 | uint32 | uint64

    Name-Value Arguments

    collapse all

    Specify optional pairs of arguments as Name1=Value1,...,NameN=ValueN, where Name is the argument name and Value is the corresponding value. Name-value arguments must appear after other arguments, but the order of the pairs does not matter.

    Example: rnaplot(RNA2ndStructure,Selection="Unpaired")

    RNA secondary structure sequence to plot, specified as a string scalar, character vector, or structure containing a Sequence field. The information in Sequuence is used in the data tip displayed by clicking a base in the plot of the RNA secondary structure RNA2ndStruct.

    Example: "GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG"

    Data Types: string | char | struct

    Plot format, specified as "Circle", "Diagram", "Dotdiagram", "Graph", "Mountain", or "Tree". The choices are described in this table.

    FormatDescription
    "Circle"

    Each base is represented by a dot on the circumference of a circle. Lines connect bases that pair with each other.

    "Diagram"

    Each base is represented and identified by a letter. The backbone and hydrogen bonds between base pairs are represented by lines.

    Note

    If you specify Format as "Diagram", then you must also specify a value for Sequence to provide the RNA sequence.

    "Dotdiagram"

    Each base is represented and identified by a dot. The backbone and hydrogen bonds between base pairs are represented by lines.

    "Graph"

    Bases are displayed in their sequence position along the abscissa (horizontal axis) of a graph. Semi-elliptical curves connect bases that pair with each other. The height of the lines is proportional to the distance between paired bases.

    "Mountain"

    Each base is represented by a dot in a two-dimensional plot, where the base position is in the abscissa (horizontal axis) and the number of base pairs enclosing a given base is in the ordinate (vertical axis).

    "Tree"

    Each base is represented by a node in a tree graph. Leaf nodes indicate unpaired bases, while each internal node indicates a base pair. The tree root is a fictitious node, not associated with any base in the secondary structure.

    Note

    If you specify Format as "Tree", then you cannot specify ColorBy as "Residue".

    Data Types: string | char

    Residues to highlight in plot, specified as a numeric vector, a string scalar, or a character vector. If you specify Selection as a numeric vector, then the rnaplot function highlights the residues whose indices appear as entries in Selection. If you specify Selection as a string scalar or character vector, then the rnaplot function highlights the subset of residues described by Selection. In this case, Selection must have one of these values:

    • "Paired"

    • "Unpaired"

    • "AU" (or "UA")

    • "GC" (or "CG")

    • "GU" (or "UG")

    Note

    If you specify Selection as "AU", "GC", or "GU" (or "UA", "CG", or "UG"), then you must also specify a value for Sequence to provide the RNA sequence.

    Data Types: double | single | int8 | int16 | int32 | int64 | uint8 | uint16 | uint32 | uint64 | string | char

    Color scheme for plot, specified as "State", "Residue", or "Pair". The choices are described in this list.

    • "State" — Color by pair state: paired bases and unpaired bases.

    • "Residue" — Color by residue type: A, C, G, and U.

    • "Pair" — Color by pair type: AU/UA, GC/CG, and GU/UG.

    Note

    If you specify ColorBy as "Residue" or "Pair", then you must also specify a value for Sequence to provide the RNA sequence.

    Data Types: string | char

    Output Arguments

    collapse all

    Handle to axes, returned as an Axes object.

    Handles from plot, returned as a structure. Depending on the values you choose for Selection and ColorBy, H can contain these fields:

    • Paired — Handles to all paired residues

    • Unpaired — Handles to all unpaired residues

    • A — Handles to all A residues

    • C — Handles to all C residues

    • G — Handles to all G residues

    • U — Handles to all U residues

    • AU — Handles to all AU/UA pairs

    • GC — Handles to all GC/CG pairs

    • GU — Handles to all GU/UG pairs

    • Selected — Handles to all selected residues

    Tip

    Use the handles returned in H to change properties of the graph elements, such as color, marker size, and marker type.

    Version History

    Introduced in R2007b