Community Profile

photo

Jan


Last seen: Today
13,455 total contributions since 2009

It is easier to solve a problem than to guess, what the problem is.

Questions about FileExchange submissions are welcome - get my address from the code. I do not answer mails concerning questions in the forum.

Jan's Badges

  • Explorer
  • Personal Best Downloads Level 4
  • Editor's Pick
  • First Review
  • 5-Star Galaxy Level 5
  • First Submission
  • Grand Master
  • Revival Level 4
  • 36 Month Streak
  • Thankful Level 4
  • Knowledgeable Level 4
  • First Answer
  • Promoter
  • Commenter
  • Solver

View details...

Contributions in
View by

Answered
Transparency violation error. Using 'eval' in a 'parfor' loop
Some general hints: load() without catching its output to a variable creates variables dynamically in the workspace. This imped...

1 day ago | 1

Answered
Matrix multiplication to get covariance matrix
No, there is no chance for a significant speedup or vectorization, because the result of the former iteration is the input of th...

1 day ago | 0

Answered
Run the same script for multiple folders
See: FAQ: How to access a sequence of files FolderList = dir('C:\Your\BaseFolder\'): FolderList = FolderList([FolderList.isdir...

1 day ago | 0

Answered
How to create a 7*9 black and white image by using 0 and 1?
T = [0, 0, 0, 0, 0, 0, 0, 0, 0; ... 0, 1, 1, 1, 0, 1, 1, 1, 0; ... 0, 0, 1, 0, 0, 1, 0, 1, 0; ... 0, 0, 1, 0, ...

1 day ago | 1

Answered
How to perfrom indexing on nested cell array ?
Are you aware that cellfun looks really nice, but that the code runs faster with loops? In your case you see, that a simple loo...

1 day ago | 1

| accepted

Answered
Using index to name variables
Do not create variables names dynamically. This would store information in the names, where it is hard to access. Use the values...

1 day ago | 0

| accepted

Answered
Need help for "error using -mex file"
The message means, that the subfolder "gsl/" cannot be found. Then provide its base folder by the -I parameter. See: https://www...

1 day ago | 0

| accepted

Answered
Filter function in MATLAB
Did you read the documentation already? doc filter doc filtfilt filter() introduces a delay between input and output signals,...

1 day ago | 0

Answered
different reactions to right/left click
Comparing char vectors by == fails, if the number of characters is not equal. '123' == 'abc' % Working '1234' == '0' % W...

2 days ago | 0

| accepted

Answered
How do I fix the "A METHODS block or END might be missing before the function definition. This might be causing additional error messages." issue.
The conditions are not recognized in the "elseif" commands. If you really want to move them to the next line, insert the line co...

2 days ago | 1

Answered
Random line segments confined in a box
figure; axes('XLim', [-0.1, 1.1], 'YLim', [-0.1, 1.1]); nLine = 100; Coor = [0, 1, 1, 0, 0; ... 0, 0, 1, 1, 0]; for...

2 days ago | 2

| accepted

Answered
while loop in matlab
What's wrong with while true in Matlab?

2 days ago | 2

| accepted

Answered
How to save data from edit text using a push button in a GUI?
"With a pushbutton I want to close the GUI and save all the data from the edit boxes." Closing is easy: close(handle.figure1) ...

2 days ago | 1

| accepted

Answered
readtable interpretes time hh:mm:ss:SSS in different ways
I do not understand the meaning of your file operations. As far as I understand, the problem can be reproduced by: RA = readtab...

2 days ago | 0

| accepted

Answered
While loops in ode45
You do not reset erro to inf after the first iteration. Then all following iterations are not entered. Replace: erro = inf; ....

3 days ago | 0

Answered
Coupled differential equation using ODE 45
Yes, of course the values are 0. The initial value of y(1) is 0. The derivative of y(1) is: dwp0dz = ((s * alpha0 * y(1) * x0)...

3 days ago | 1

| accepted

Answered
How can I make sphere using smaller spheres?
r = 0.1; R = 1; [x, y, z] = sphere(12); w = linspace(-R + r, R - r, 1 + R / r); figure; axes('NextPlot', 'add', 'XLim', [-R...

3 days ago | 2

| accepted

Answered
How to assign a row matrix to another row matrix
The error message suggests: To convert to numeric, use the TABLE2ARRAY function Did you try this already? In one line you w...

3 days ago | 0

Answered
Insert an input to an exe automatically by Command Window
You could use this to inject keystrokes: https://www.mathworks.com/matlabcentral/fileexchange/40001-keyinject The function must...

3 days ago | 1

| accepted

Answered
ODE45 function time step
Avoid using global variables, because they are a shot in your knee. Use a persistent variable instead and reply it to the calle...

3 days ago | 0

Answered
Repeating while loop until the conditions are met
It is not getting clear to me, what you are asking for. So some hints at first: Pi=0; sumPi=0; P=zeros(n,1); for j=1:n ...

3 days ago | 0

Answered
Turn off "Improve MATLAB by sending user experience" from the command line
What about setting this parameter through the GUI and comparing C:\Users\<USER>\AppData\Roaming\MathWorks\MATLAB\<VErSION>\mat...

3 days ago | 0

Answered
How to create an array from a GUI where the array length changes by user's input?
The easiest way is to omit step 1, but to let the use create as many values as wanted and count them afterwards. There is a nice...

4 days ago | 1

| accepted

Answered
How to Count occurrences?
t = 'tagtacagccagtagagttgattccaaggaagtccggctgttgtagagtagc'; tag = 'tag'; result = sum(strfind(lower(t), lower(tag)))

4 days ago | 1

Answered
several plot - subplot for-loop
Maybe: ... subplot(1, length(Files), k); yyaxis left plot(p,ODsatpercent,'bo--'); yyaxis right pl...

4 days ago | 1

Answered
How to doI plot F(x) = [1 -(10/x)]/[1-(100/x^2)] for X ranging from 100 to 1100 at an interval of 50?
x = 100:50:1100; plot(x, (1 - (10 ./ x)) ./ (1 - (100 ./ x.^2))); With some basic maths skills, a simplification is easy: plo...

4 days ago | 2

Answered
How to change output in FOR Loop
Creating variables dynamically has a lot of severe disadvantaged. Using a struct is nicer, safer and more efficient. X = {'JanL...

4 days ago | 0

Answered
Mis-type append problem
The problem is, that you provide CHAR vectors, but scatter requires numerical arrays. readtable would be smart, but this works ...

4 days ago | 0

Answered
Error using ode45
The error message means, that you need a function, because the integrator uses input and output arguments for the function to be...

7 days ago | 0

| accepted

Answered
How to solve this ODE system which involves these integrals?
What about using two further variables? function dx = fcn(z, x) dx = [f1(x(1), x(2)) / x(3); ... f2(x(1), x(2)) / x(4);...

7 days ago | 0

| accepted

Load more